Embryos were collected and chilled every 15 minutes until approximately 200 μl of packed embryos

were obtained per replicate. The eggs were stored at -80C until DNA extractions could be performed. Synchronization of larvae was accomplished by allowing several hundred females to oviposit on egg-laying dishes for one hour. The eggs were collected and seeded onto standard media. From these, third instar (3′) larvae were collected and stored at -80C until DNA extraction. DNA was extracted from all tissues and flies with the DNeasy Blood and Tissue Kit (Qiagen) using the manufacturer’s protocol with an extended, overnight Nepicastat proteinase K digestion. DNA purity and concentration was determined using a Nanodrop ND1000. Quantitative PCR for relative copy number Relative copy numbers of Wolbachia and WO phage in .D. simulans were obtained using the MiniOpticon System (Bio-Rad). The relative Wolbachia infection level was measured by comparing the copy number of the gene for Wolbachia JPH203 surface protein, wsp, to a single copy gene in the Drosophila genome, CuZn superoxide dismutase (sod). Phage copy numbers were measured by comparing the adenine methyltransferase (wMTase) (WORiB), lyzozyme (WORiA), and tail tube protein (WORiC) genes to wsp in wRi (see table 1 for

locus tags and primer sequences). Table 1 Primer sequences used in this study ORF Product Locus Tag Specificity Sequence (5′-3′) Superoxide Dsim GD12822 D. simulans F – GTCGACGAGAATCGTCACCT Dismutase (SOD)     R – GGAGTCGGTGATGTTGACCT Surface Antigen WRi 010990 Wolbachia F – ATCAGGGTTGATGTTGAAGG

Wsp (Wsp)   w Ri R – CAGTATCTGGGTTAAATGCTG Lyzozyme M1 WRi 012650 WORiA F – GACTTTATGGCAGTATACCGA (Lyz)     R – TGTTCCGTTGAATTTGTTCC DNA WRi 005640 WORiB F – CTTAAATGACCATCAACCACAG Methyltransferase (MTase)     R – GCTTCAATCAGGGAATTTGG Metalloexopeptidase Contractile Tail WRi 006970 WORiC F- GTTGATGGTAGAGGTTATGCAG Tube Protein     R – GAATATCCATACCACCAGCTC Reactions were performed in low profile 48-well white plates with flat cap strips (Bio-Rad). Ten microliter reactions included 400nM of each forward and reverse primer, 5 μl of 2× Dynamite qPCR mastermix (YH25448 in vivo Molecular Biology Service Unit – University of Alberta) which included SYBR green (Molecular Probes) and Platinum Taq (Invitrogen), and 125ng of DNA. The thermal cycling conditions were 95°C for 2 minutes, 40 cycles of 95°C, 55°C, and 72°C for 30 seconds each, and a final 2 minute 72°C extension. Fluorescent data were acquired after every 72°C extension. A 60-95°C melting curve was performed to confirm the specificity of the products. No template controls were included to account for DNA contamination. All samples were analyzed in technical and biological triplicates.