We also addressed the potential role of ShET-2 in Shigella pathogenesis by comparing the wild type and ShET-2 mutant for differences in known Shigella pathogenesis models. Our data suggest a contribution of ShET-2 to inflammation 3-MA induced by Shigella infection in epithelial cells. The bacterial strains and plasmids used in this study are described in Table 1. Shigella flexneri strains were grown on trypticase soy agar (Oxoid Ltd, Cambridge, UK) with CR dye (Sigma Chemical Co., St. Louis, MO). For molecular biology experiments, all strains were routinely cultured in Luria–Bertani (LB) broth at 37 °C with aeration. Antibiotics,

when used, were added to broth or agar to the following concentrations: ampicillin 100 μg mL−1 and kanamycin 50 μg mL−1. Shigella T3SS-mutant strains were kindly provided by Dr Anthony Maurelli. The full-length click here sen gene was amplified by PCR using wild-type S. flexneri strain 2457T total DNA as a template with primers D3C-F (5′-GAGGAATAATAAATGCCATCAGTAAATTTA) and D3C-R (GCTTTTATATTCTTCATAA). The ∼1.7-kb PCR product was purified and ligated to the pBAD-TOPO® vector (Invitrogen, Carlsbad, CA) and the plasmid obtained, pSen, was transferred to E. coli DH5α (Invitrogen). A sen deletion mutant in wild-type S. flexneri strain 2457T was made by the one-step

gene disruption method described by Datsenko & Wanner (2000). Plasmid pKD4 was used as a template for PCR with the primers pKD4-F (CAACAACACTAAGTCTGCGTCACAACCCATCAATGAAAGGGTGTAGGCTGGAGCTGCTTC) and pKD4-R (GTTACCTCAAATTCAGTGTATCACCACGAGATAATATTCACATATGAATATCCTCCTTA) to amplify a KmR marker flanked by sen-specific sequences. The PCR product obtained was purified and transferred to S. flexneri strain 2457T carrying the λ-red helper plasmid pKD46. After replacement Farnesyltransferase of the target gene by the KmR marker, FLP-mediated recombination was performed to remove the resistance marker to obtain 2457Tsen. The deletion was confirmed by Southern blot and

nucleotide sequencing. Induction of T3SS secretion was carried out as described previously (Bahrani et al., 1997). Briefly, S. flexneri wild-type and mutant strains carrying pSen plasmid precultures were diluted 1 : 100 in 3 mL of LB medium plus 0.02% arabinose and incubated at 37 °C with shaking for 4 h. The culture was centrifuged and the pellet was resuspended in 2 mL of phosphate-buffered saline (PBS; pH 7.4). CR was added to cells to a final concentration of 20 μM and were incubated for 10 min at 37 °C stationary and then for 20 min with aeration. Bacterial cells were centrifuged (14 000 g, 10 min) and the supernatant was filtered with a 0.45-μm-pore-size filter and concentrated 10-fold using a Centricon-30000 MWCO spin column (Millipore, Billerica, MA) for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblot analyses. Protein electrophoresis was performed in 12.