The geographical distribution of these migrants is heterogeneous, the majority (68.8%) living in southern Portugal [20]. Therefore, it is not surprising www.selleckchem.com/products/nu7441.html to find that native Africans living in the capital (Lisbon) represent the majority of the most recently diagnosed cases of HIV-2 infection. In addition, as two large hospitals located in southern Portugal are not represented in our sample, this epidemiological change is probably underestimated. The general area of residence (north/south) was extrapolated taking into account the hospital where patients were diagnosed and followed, although some patients may not have attended a hospital in their area

of residence. Nonetheless, CX-5461 purchase we believe that only a minority would travel more than 300 km to attend another hospital. Data from a Portuguese study addressing this issue revealed that the average distance from a patient’s residence to a hospital where HIV-infected patients were admitted was 13 km [21]. Interestingly, there has been over the study period a steeper increase in age at the time of diagnosis, statistically significant for men. However, the proportion of patients presenting with AIDS has not changed substantially. Does this mean that men are being infected later and tested earlier in the course of the infection or, on the contrary, are they being diagnosed at an older age and later

but remaining asymptomatic as a result of a slower progression of the disease? Testing for HIV has been performed routinely for blood donations since 1985 and recommendations for screening women before or during pregnancy date back to 1998. Further, there have been campaigns over the last few decades promoting HIV testing of those

with a history of injecting drug use, unprotected sexual intercourse or transfusions, particularly in Africa, although information related to the uptake of testing over time, either patient- or provider-initiated, is not available. Studies addressing HIV testing practices and disease progression are needed Fludarabine to answer these and related questions. Experience with the treatment of HIV-2-infected patients on antiretroviral therapy is limited; when to start and which antiretroviral regimen to choose are still poorly defined. In our sample, we found that, although the majority of patients were treatment-naïve, the proportion of patients who had experienced more than two different treatment regimens (14.5% of those ever treated) highlights the need to improve the evidence base for decisions on which therapy to initiate. People living with HIV experienced a major change in survival rates after the introduction of effective treatment regimens. Whether the same applies to the prognosis of HIV-2-infected patients is not known.

Mineralization of [14C]phenanthrene to 14CO2 was measured in contaminated soils at temperatures down to 0 °C and sizable naphthalene-, undecane-, biphenyl- and phenanthrene-degrading SAHA HDAC populations were measured by microplate-based most-probable-number analysis. Cloning and 16S rRNA gene sequencing, focused on the dominant phenanthrene-degrading bacteria, revealed strains related to bacteria previously found in cold and contaminated environments. Overall, we provide evidence

for the presence and potential activity of phenanthrene-degrading bacteria in polluted St. Nord soils and this study is the first to indicate an intrinsic bioremediation potential in hydrocarbon-contaminated soils from the Greenland High Arctic. The Arctic warming and the reduction in the polar ice sheet during the last few years (Graversen et al., 2008) will boost human activity in the High Arctic regions of Greenland. This will inevitably lead to increased inputs of anthropogenic compounds and the issue arises as to whether an intrinsic attenuation

potential is present in these areas. Intrinsic remediation of petroleum hydrocarbons under cold conditions have been indicated before (Bradley & Chapelle, 1995; Aislabie et al., 1998; Rike et al., 2005) and contaminated alpine, Antarctic and Arctic soils may harbour hydrocarbon-degrading populations (Margesin & Schinner, Bafilomycin A1 2001; Rike et al., 2003; Saul et al., 2005; Aislabie et al., 2006). In some cases, however, the natural attenuation potential present in these cold environments is insufficient to clean up soils within a reasonable time and active bioremediation approaches have been suggested (Filler et al., 2001; Margesin & Schinner, 2001). Studies on contaminant degradation in High Arctic regions have until now addressed areas in Alaska (Bradley & Chapelle, 1995; Filler et al., 2001), Canada (Whyte et al., 2001) and Svalbard (Rike et al., 2003, 2005), but no studies have focused on the Greenland

High Arctic. Previous studies have mainly focused on the fate of easily biodegradable oil fractions, whereas knowledge on the biodegradation selleck screening library of polycyclic aromatic hydrocarbons (PAHs) in Arctic regions is lacking. Station Nord (St. Nord) is a military base operated by the Danish army located at 81°36′N and 16°40′W approximately 500 miles from the geographical North Pole. The area is an Arctic desert with an average annual air temperature of −14 °C and <100 mm annual precipitation. The temperature can reach 16 °C during the summer period and down to −50 °C during the winter. St. Nord is a gateway to the national park in the northern part of Greenland as well as the North Pole and the storage and handling of fuels have led to accidental spillage. In addition, St.

Propensity score matching was performed using logistic regression analyses, with the index treatment as the dependent variable and all measured baseline characteristics as independent variables. Covariates included demographics, indicators of disease severity and comorbidities; those that reached significance at the P ≤ 0.05 level were used to create the propensity score. For bDMARD compared to tDMARD use, propensity score covariates included age, chronic obstructive pulmonary disease (COPD)/asthma, diabetes, disease duration, number of tDMARDs, sex and steroid exposure. For within-bDMARD use comparisons (etanercept vs. adalimumab), propensity score covariates

included disease duration, number of tDMARDs and steroid exposure. Baseline characteristics included in this www.selleckchem.com/products/AZD2281(Olaparib).html study were age (standardized to the end of the study period), sex, duration of disease (from first observed

RA diagnosis until the end of the study period), number of different tDMARDs prescribed, patient exposure to steroids (including betamethasone, cortisone, dexamethasone, fluocortolone, hydrocortisone, methylprednisolone, paramethasone, prednisolone, prednisone, prednylidene and triamcinolone), and comorbidities present in the 180-day period prior to initial RA diagnosis date, defined by ICD-9-CM codes. Comorbidities included diabetes mellitus, excluding type 1 (250.xx, excluding 250.x1 and 250.x3), COPD/asthma (493.xx), hypertension (401.xx) and hyperlipidemia (272.0, 272.1, 272.2 and 272.4). Cases were identified as any patient Cyclopamine cost selleck with the presence of SBI requiring hospitalization or one or more ICD-9-CM codes for TB (010.xx–018.xx) or lymphoma (202.8) during the interval between the first RA diagnosis and study end. SBI ICD-9-CM codes included those for encephalitis (323.x, 054.3), endocarditis (421.x), meningitis (320.x, 049.x), osteomyelitis (730.0x, 730.1x, 730.2x), pneumonia (481.x, 482.x), pyelonephritis (590.x), septic arthritis (711.0x, excluding 711.08), and septicemia or bacteremia (038.x, 790.7). Exposure

to DMARD treatment was calculated in patient years, starting on the date of first RA diagnosis. For case patients, this included the number of years between the initiation date for tDMARD or bDMARD and the occurrence of the safety endpoint (SBI, TB or lymphoma). For non-case patients, this included the number of years between the first tDMARD or bDMARD initiation and the end of the observation period (31 December 2009). Only adverse events that occurred during the period of drug use or within 90 days following the last prescription administered were considered valid. In cases where multiple events occurred for one patient, all events were recorded. The incidence rate and incidence rate ratio (IRR) were computed for the propensity score-matched cohorts.

Beyond the antennal lobe we observed astrocyte-like glial spontaneous

calcium activities in the ventromedial protocerebrum, indicating that astrocyte-like glial spontaneous calcium elevations might be general in the adult fly brain. Overall, our study demonstrates a new function for astrocyte-like glial cells in the physiological modulation of olfactory information transmission, possibly through regulating ORN–PN synapse strength. “
“In many retinal diseases, it is the death of photoreceptors that leads to blindness. In previous in vitro and in vivo studies, basic fibroblast growth factor (bFGF) has been shown to increase retinal cell survival. More recently, reactive oxygen species (ROS) have also been shown to promote cell survival, contrary to the traditional view that they are solely destructive molecules. Due to this possible link, click here we hypothesised that bFGF could stimulate the production

of ROS, which in turn stimulates the protein kinase B (Akt) survival pathway. Flow cytometry was used to measure the fluorescence of oxidised dihydrorhodamine, a ROS indicator, in the murine 661W photoreceptor cell line under several different conditions. Expression of cyclooxygenase (Cox) enzymes was evaluated by immunohistochemistry, and the response of photoreceptor cells to exogenous bFGF in the explanted mouse retina was studied by confocal microscopy. Exogenous addition of bFGF to 661W cells resulted in an increase in ROS production that lasted for 24 h. When this ROS production was inhibited, Cediranib (AZD2171) bFGF-induced phosphorylation of Akt was prevented. Through the use of inhibitors and Selleckchem NVP-BGJ398 small interfering RNA in the cell line, the source of this production was shown to be Cox and to involve the activation of phospholipases A2 + C. This pathway may also occur in the mouse retina, as we showed that the retina expressed Cox1&2, and that photoreceptors in explanted retina respond to bFGF by increasing their ROS levels. These results demonstrate that exogenous bFGF can stimulate ROS production

through the activation of Cox, and activate the Akt pathway. “
“Amyloid beta (Aβ), a key component in the pathophysiology of Alzheimer’s disease, is thought to target excitatory synapses early in the disease. However, the mechanism by which Aβ weakens synapses is not well understood. Here we showed that the PDZ domain protein, protein interacting with C kinase 1 (PICK1), was required for Aβ to weaken synapses. In mice lacking PICK1, elevations of Aβ failed to depress synaptic transmission in cultured brain slices. In dissociated cultured neurons, Aβ failed to reduce surface α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor subunit 2, a subunit of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors that binds with PICK1 through a PDZ ligand–domain interaction.

sigmaaldrich.com). To equalize the cell densities, the cells

were collected by centrifugation, washed once in basal salts (medium Transferase inhibitor without carbon source) and resuspended in basal salts to yield an OD600 nm of 0.375. An inoculum of 20 μL was added to 130 μL of prewarmed medium in 96-well microtiter plates (round-bottom plates; Sarstedt, Nümbrecht, Germany). Thereby, the starting OD600 nm of all cultures was set to 0.05. Cultures were grown on a Heidolph Titramax 1000 rotary shaker (Heidolph, Schwalbach, Germany), which has an orbit of 1.5 mm, with 1100 r.p.m. at 42 °C. The OD600 nm was measured at the time points indicated in the respective Figures using the microtiter plate photometer Spectramax 340 (Molecular Devices, Ismaning,

Germany). Optimization of the cultivation of H. volcanii buy DZNeP in microtiter plates and the optimized protocol are described in Materials and methods. If not otherwise stated, strain H. volcanii H26 (Allers et al., 2004) was used for all the experiments, which is auxotrophic for uracil, but wild type in terms of all the features tested in the experiments described below. The strain was chosen because it is widely used by many groups for the generation of deletion mutants. As a first application, growth in microtiter plates was used to characterize the dependence of the growth yield on the glucose concentration. Eight different glucose concentrations were used in the presence of two different vitamin sources, 0.01% w/v yeast extract and 0.1% v/v of a commercially available mixture of nine vitamins (the vitamin dependence is discussed below). The growth curves are shown in Supporting Information, Fig. S1a and S1b. The dependence of the growth yield on the glucose concentration for both sets of experiments is shown in Fig. 1a. In all three figures, the average values of six independent cultures and their variations are shown. As can be seen, the growth of H. volcanii under the optimized conditions in 96-well microtiter plates is extremely reproducible. The dependence of the growth yield on the glucose

concentration was very similar in the presence of 0.01% yeast extract ioxilan and the vitamin mixture, respectively. The biggest difference is in the negative control, i.e. in the absence of glucose. As expected, 0.01% yeast extract can also be used to a small extent as a carbon and energy source. Therefore, all the following experiments were conducted in the presence of the vitamin mixture, except for the analysis of vitamin dependence. In a next experiment, the dependence of the growth yield of H. volcanii on the concentration of casamino acids as the sole carbon and energy source was clarified. The growth curves are shown in Fig. S2 and the dependence of the growth yield on the casamino concentration is shown in Fig. 1b.

The primary analysis was performed Y27632 on baseline-normalized rather than raw MEPs (as the variance was generally smaller for the former). Analysis used PASW Statistics 17.0.2 (SPSS, Chicago, IL, USA). In a verification procedure, we computed root mean square pre-TMS EMG activity for each condition in order to establish if the muscle of interest was at rest at the time of stimulation. The key hypothesis in Experiment 1 was that MEPs would increase with urge. Accordingly, we tested whether there was a linear increase from neutral to weakly wanted to strongly wanted items at early and late time-points separately. The same analysis was also done for RT. In addition, we used aversive food stimuli to both increase the range of

subjective urge measurements and to examine the relationship between MEP and ‘negative’ urges (i.e. motor system responses for items the participant

did not Selleckchem Dabrafenib want to consume). We did not have any prediction about how MEPs would relate to the strength of the negative urges. The key hypothesis for Experiment 2a was that MEPs would be greater for the $5 stimulus than the 10 cent stimulus. For Experiment 2b, we were interested to see if the absence of action would produce the same or different results from Experiment 2a. For Experiment 1, a linear contrast across wanting levels showed that normalized MEPs increased significantly with increasing urge for the late period (F1,15 = 6.536, P = 0.022), but not for the early period (F1,15 = 0.191, n.s.; Fig. 1C). Post hoc, Bonferroni-corrected tests for the late period showed a significant difference in normalized MEPs between the strongly wanted and the neutral conditions (t15 = 2.557, P < 0.0167), and for the strongly wanted and the weakly wanted conditions (t15 = 2.371, P < 0.0167), but not for the weakly wanted compared with the neutral condition (t15 < 1). These effects remained unaltered when raw (rather than baseline-normalized) MEPs were used in the analysis. A linear contrast across wanting levels

also showed that RT got faster with increasing consumption urge (F1,15 = 8.072, P = 0.012). Post hoc, Bonferroni-corrected tests revealed a significant ever decrease in RT for the strongly wanted compared with the neutral condition (t15 = 2.841, P < 0.0167), and for the weakly wanted compared with the neutral condition (t15 = 2.619, P < 0.0167), but not for the strongly wanted compared with the weakly wanted condition (t15 < 1). A verification analysis of root mean square pre-TMS EMG activity showed that the muscle was equally at ‘rest’ for the comparison of strongly wanted and neutral conditions (t15 < 1, n.s.). To analyse ‘negative urges’, for which we had no predictions, we performed a repeated-measures anova for the neutral, the weakly unwanted and the strongly unwanted conditions for the early and late periods separately. This did not reveal any significant effect of ‘negative urges’ on normalized MEPs, for the early (F2,30 = 2.35, n.s.) or the late (F2,30 < 1, n.s.) stimulation periods.

suis using the QIAquick miniprep kit with the following modification: cell pellets were suspended in P1 buffer; a final concentration

of 1 mg mL−1 lysozyme was added and incubated for 30 min at 37 °C. Southern hybridizations were performed according to Sirois & Szatmari (1995). PCR were performed using a CyclePro Thermocycler (Biometra) with either Vent DNA polymerase or Phusion DNA polymerase (NEB). The S. suis xerS gene was amplified using primers SsuisXerCFwd (GATGAGACGCGAGTTATTATTGG) and SsuisXerCRev (TCACAACTGATCCAGAGCAT). The S. suis xerS gene with its native promoter was amplified using SsuisXerCFullFwd (CAAACCGCATTGCTCTGCCG) and SsuisXerCFullRev (GGACCAGTACCCAGCAGTC). An internal sequence of the xerS gene was amplified using the primers: SSXerCinF (CTATGAATTCGGGAGCGTCCCTTGCT) and Alpelisib purchase SSXerCinR (CTTCGAATTCGGCAGACCACGGTATTCG). The S. suis dif region was amplified with Dif-SL-F (TTCCAGTTTTGTCGTTATTAAAGTAC) and Dif-SL-R (TTTCTTTTAGTTGATCAATTTTTTCC) and cloned in the SmaI site of pUC19 to generate pUCdifSL, which was used to generate partial deletions of the difSL site using Phusion site-directed mutagenesis (NEB). Primers DifSLDSGF (CTTATATAAGGTTATGCTATCTACTCATAT) and DifSLDSGR (TTATAGTTTTTCGGAAAAATGTTTGTGGG) Gemcitabine in vivo were used to delete the right half-site of difSL, and DifSLDSDF (ACTATAATTTTCTTGAAACTTATAGGTTATGCT)

and DifSLDSDR (GTTTGTGGGGATATTAGAAAGATAACC) were used to delete the left half-site of difSL. DNA-binding substrates for mobility shift assays were amplified using the M13F and the 5′ HEX-labelled M13R universal sequencing primers. All cloned PCR products were verified by sequencing at the IRIC genomic facility of the Université de Montréal. The S. suis xerS gene was amplified by PCR using Vent polymerase as described previously, cloned into pMalC2 and the resulting plasmid was used to transform E. coli strain DS9029.

The protein was expressed as an MBP fusion to increase its solubility. Cells were incubated in auto-inducible media (Studier, 2005) at 37 °C overnight, Fossariinae and cell extracts were passed through an amylose column prepared according to the manufacturer’s directions or were purified on a MBP-trap column (GE Healthcare) according to the manufacturer’s directions. Proteins were separated by SDS-PAGE on 14.5% gels and visualized by Coomassie blue staining. Protein concentrations were estimated by the Nano-drop spectrophotometer (Thermo Scientific). Specific DNA binding was determined by the gel retardation assay (Jouan & Szatmari, 2003) using specific fragments labelled at the 5′ end with 6-HEX using PCR. DNA binding assays were performed in 20-μL volumes using TENg buffer (20 mM Tris-HCl, pH 7.5, 1 mM EDTA, 25 mM NaCl and 5% glycerol) with 1 μg polydIdC (average mol. wt. 20 000 bp; Roche) and HEX-labelled dif sites. Detection was carried out with the Typhoon 9410 imager, and images were analysed by Imagequant software (GE Healthcare). Nicked suicide substrates (Fig. 2c) were prepared as described by Blakely et al. (1997).

, 1989; Brouard et al., 1998). These fragments were purified and fused together in a second PCR step. The fusion product was subsequently amplified. The PCR products were separated and purified before ligation into the previously Selleck Epacadostat described pESC-α vector (Jeon et al., 2009), resulting in pESC-α-cCelE. For expression of genes, pADHα (Fig. 2), which was designed to consist of the alcohol dehydrogenase 1 (ADH1) promoter and the previously described α-mating factor gene (Jeon et al., 2009), was used as a vector. The ADH1 promoter and α-mating factor gene from S. cerevisiae were linked by a multistep PCR strategy using pairs of overlapping primers as described above: ADHα P1,

ADHα P2, ADHα P3, and ADHα P4 (Table 1). The PCR products were separated and purified before ligation into the pESC-TRP vector (Clontech Laboratories Inc.), resulting in the pADHα vector (Fig. 2). For construction of chimeric CelE-doc and Bgl1 expressing vectors, the chimeric CelE-doc gene was amplified by PCR with the pESC-α-cCelE plasmid as a template and the primers cCelE P1 and cCelE P4, and the Bgl1 gene was amplified by PCR using the previously described pαBG1 plasmid (Jeon et al., 2009) as a template PD0332991 price and the primers Bgl1_f and Bgl1_r. The fragments were inserted into the NotI–SpeI site of the pADHα vector. The resulting plasmids were named pADH-α-cCelE and pADH-α-Bgl1 (Fig. 2). The mini-CbpA was designed to consist of a CBD, a hydrophilic domain, and

two cohesins of scaffolding protein CbpA (Shoseyov et al., 1992) (Fig. 1b). The mini-CbpA gene was amplified using genomic DNA from C. cellulovorans as a template and the primers mCbpA_f and mCbpA_r. The PCR primers were designed to allow in-frame fusion at the N-terminal 2-hydroxyphytanoyl-CoA lyase end of mini-CbpA with the α-mating factor and at the C-terminal end with the FLAG tag from the pADHα vector. The amplified fragment was inserted into the NotI–SpeI site of the pADHα vector. The resulting plasmid was named pADH-α-mCbpA (Fig. 2). The plasmid pADHαcCelEmCbpA, used for simultaneous production of chimeric CelE-doc and mini-CbpA, was constructed as follows: a gene carrying the chimeric CelE-doc

cassette, which consisted of the ADH1 promoter, α-mating factor, chimeric CelE-doc gene, FLAG tag, and ADH1 terminator, was amplified by PCR using the pADH-α-cCelE plasmid as a template, and the primers cCelEcas_f and cCelEcas_r. The amplified chimeric CelE-doc expression cassette was digested with XhoI and SalI and inserted into the XhoI–SalI site of the pADH-α-mCbpA plasmid; the resulting plasmid was called pADHαcCelEmCbpA (Fig. 2). Transformation of S. cerevisiae with the constructed plasmids was carried out using the lithium acetate method with the Yeastmaker yeast transformation system (Clontech Laboratories Inc.). Plasmids were introduced into S. cerevisiae YPH499. The transformed clones were selected on SD plates without l-tryptophan. For inoculum preparations, yeast strains were cultivated at 30 °C with shaking at 200 r.p.m.

Identifying the mechanisms bacteria use to escape the current Talazoparib datasheet antimicrobial treatments is essential to containing potential outbreaks and developing new antimicrobial therapies. Many bacteria naturally encode nonessential resistance genes on their chromosome enabling their survival and/or persistence in the presence of antibiotics using enzymes and efflux pumps. This

study investigates the ability of an evolutionarily conserved essential gene to provide resistance against antimicrobial compounds. An Escherichia coli chromosomally encoded thymidylate kinase (tmk) conditional lethal strain was developed to investigate tmk alleles from relevant nosocomial pathogens. The thymidylate kinase conditional lethal strain harboring a plasmid with a tmk gene from Mycobacterium tuberculosis, methicillin-resistant

Staphylococcus aureus (MRSA), or Pseudomonas aeruginosa downstream of an inducible promoter was examined for survival against increasing concentrations of 3′-azido-3′-deoxythymidine (AZT). The results indicate that M. tuberculosis and MRSA thymidylate kinases are deficient in cellular activity toward AZT monophosphate. “
“DnrO is a transcription factor that regulates biosynthesis of secondary metabolite daunorubicin (DNR) in Streptomyces peucetius. DNR is a DNA-intercalating drug widely used in cancer chemotherapy. Binding of DnrO close to GSK J4 in vitro its promoter fulfils dual functions, namely activation of dnrN and repression of dnrO. DnrN protein binds to a sequence close to the dnrI promoter to activate it, which is essential for turning on biosynthetic genes.

In this study, Teicoplanin we analyzed the inhibition of DNA–DnrO complex formation by DNR and its effect on dnrO and dnrN expression. The intracellular concentration of drug required to alter the expression of these two genes was determined in vitro. Based on the results, a model is proposed which describes the modulation of dnrN and dnrO expression by intracellular stoichiometric concentration of the drug DNR and protein DnrO. This regulatory mechanism would maintain optimal intracellular drug concen-trations in S. peucetius. This would imply that the organism has an adaptive mechanism to escape the cytotoxicity of DNR in addition to its self-resistance. Streptomyces are gram-positive GC-rich filamentous bacteria found predominantly in soil and decaying vegetation. They display intricate morphological and physiological differentiation that coincides with the production of a plethora of secondary metabolites, which includes antibiotics (Bibb, 2005). Streptomyces peucetius produces daunorubicin (DNR) and doxorubicin, which are anticancer antibiotics. The transcription of DNR biosynthetic genes in S. peucetius is tightly regulated by a three-tier mechanism, which involves regulatory genes dnrO–dnrN–dnrI (Furuya & Hutchinson, 1996; Tang et al., 1996; Otten et al., 2000).

Ninety-eight nanograms of the 5′ HEX-labelled TN or BN suicide substrates were incubated in 20 μL-reaction volumes containing TDMNG buffer (50 mM Tris pH 7.5, 5 mM DTT, 75 mM MgCl2, 25 mM NaCl and 25% glycerol) in the presence of 1.5 mM MBP-XerS each in the presence of 1 μg poly dI-dC. After a 60 min incubation at 37 °C, reactions were stopped with 5 μL

of 2% SDS and 5 μL of Orange loading dye (NEB), incubated at 100 °C for 10 min and then electrophoresed in a 6% TBE gel in the presence of 0.1% SDS, and scanned with a Autophagy inhibitor research buy Typhoon imager. The difSL cleavage site was determined using 98 ng of the 3′ FITC-labelled TN or BN suicide substrate and was incubated in 20 μL of TDMNG buffer in the presence of variable concentrations of MBP-XerS in the presence of 1 μg MAPK inhibitor poly dI-dC. After a four-hour incubation at 37 °C, reactions were stopped with 20 μL of formamide, incubated at 75 °C for 2 min and then electrophoresed in

a 20% polyacrylamide TBE gel with 6 M urea, and scanned with a Typhoon imager. Molecular weight ladders were prepared by chemical degradation of the 3′ FITC-labelled oligonucleotides following the G+A chemical sequencing protocol (Bencini et al., 1984). Under the conditions used, cleavage was observed at each nucleotide position, generating a ladder of fragments differing by a single nucleotide. The thermosensitive plasmid pBEA756 was used to inactivate the xerS gene of S. suis (Fittipaldi et al., 2007). An internal sequence of the

xerS gene was amplified by PCR and cloned into the EcoRI site of pBEA756, forming the plasmid pBEAXerCint. Plasmids were then electroporated into S. suis Pomalidomide order (prepared according to Pulliainen et al., 2003) using a Bio-Rad gene pulser using 0.2-cm cuvettes at 2.5 kV. Immediately after the pulse, 1 mL of cold THY medium supplemented with 0.3 M sucrose was added, and the samples were incubated at 28 °C for 3 h, and spread on a THA plate containing 1% yeast, 400 μg mL−1 kanamycin and incubated at 28 °C. The resulting transformants were then grown in THY broth overnight with kanamycin selection at 28 °C. Aliquots of overnight cultures were spread on selective THA plates and incubated at 37 °C to inactivate the gram-positive origin. Cells which remained kanamycin resistant, presumably had integrated the plasmid into the chromosome by homologous recombination at the xerS locus, inactivating the gene. This was confirmed by Southern blot analysis, using genomic DNA prepared from kanamycin-resistant cultures using the DNeasy tissue kit. Complementation of the xer− phenotype was observed after re-introducing a cloned xerS gene with its promoter into pGhost9, and electroporating the construct into xerS mutant cells.