In addition, stimulating the cells with 50 μM S1P resulted in oxygen radical formation comparable to ROS production in the presence of MLN0128 manufacturer 4 μM CXCL4, while 5 or 0.5 μM S1P were not effective

(Fig. 6B). Furthermore, exogenously added S1P (50 μM) significantly reduces caspase-9 activation as compared with the unstimulated control (Fig. 6C). While this effect appears to be incomplete after 24 h of treatment, inhibition of caspase-9 was comparable to that observed following CXCL4 stimulation after 48 h of incubation with S1P. Moreover, stimulation with 50 μM S1P resulted in Erk phosphorylation after 24 h of stimulation, while CXCL4 mediates a more prolonged activation of Erk (Fig. 6D). In summary, treatment with high dosages of exogenous S1P resulted in Erk phosphorylation, reduced caspase

activation, and induction of ROS production in monocytes. To address the question whether overexpression of SphK1 alone is sufficient to mimick CXCL4 stimulation, we transfected monocytes with either SphK1-plasmid or empty vector. As a control we used CXCL4-stimulated cells in the presence of the transfection reagent, and SphK1 expression as well as cell viability was tested after 72 h. As shown in Fig. 6E (right panels) CXCL4 stimulation results in a fivefold increase in SphK1 expression compared with the unstimulated control. Transfection of the empty vector already leads to a sixfold increased SphK1 expression, which is further increased to 16-fold in selleck chemicals SphK1-plasmid transfected cells. As expected, stimulation with CXCL4 results in significant reduction in both apoptotic and necrotic cell death (Fig. 6E, left panels). Furthermore, transfection with the vector or SphK1-plasmid both resulted in a significant decrease of apoptotic cells and a significant increase in necrotic cells.

More importantly, no difference could be detected between vector transfected and SphK1 overexpressing cells. These data indicate that overexpression of SphK1 is not sufficient to rescue monocytes from cell death, and at least one additional signal provided by CXCL4 Ribose-5-phosphate isomerase is required for monocyte survival. S1P is a unique signaling molecule in that it can act both as an extracellular ligand for S1P receptors (G protein-coupled receptors) and as an intracellular second messenger. It has been described that monocytes mainly express two S1P receptors, S1P1 and S1P2, and that these receptors interact amongst others with Gi proteins 12. In a next set of experiments, we tested whether CXCL4 and S1P stimulated monocyte functions are dependent on Gi protein-coupled S1P receptors. In these experiments cells were preincubated in the presence or absence of pertussis toxin (PTX) (500 ng/mL; 90 min). Subsequently, cells were stimulated with CXCL4 (4 μM), S1P (50 μM), or fMLP (1 μM; as a control) and production of ROS was recorded for 60 min. Preincubation of the cells with PTX resulted in a significant reduction of fMLP- and S1P-mediated respiratory burst by 85 and 61%, respectively (Fig.

Her studies include characterizing the role of tetrahydrobiopterin in the altered synthesis of NO in MSPH. Tamara Sáez: Miss Sáez (medical technologists) is a PhD in Biological Sciences

student at the Pontificia Universidad Católica de Chile. She is interested in the genesis and release of exosomes from the human placenta in gestational diabetes. Her studies include clarifying a potential regulatory function of released exosomes Lenvatinib on the human placenta micro- and macrovascular endothelium. Andrea Leiva: Dr Leiva (biochemists) holds a PhD in medical sciences and is an Associated Researcher dedicated to study the involvement of maternal lipids levels in the fetoplacental vascular function in human pregnancy. Her research interest includes pregnancy pathologies related with alterations

in lipid metabolism such as GDM. Recent results suggest that maternal supraphysiological hypercholesterolemia leads to fetal endothelial Metformin clinical trial dysfunction in the micro- and macrovasculature of the human placenta with an altered modulation of l-arginine/NO and arginases/urea pathways in these cell types. Fabián Pardo: Dr Pardo (medical technologists) holds a PhD in molecular and cellular biology with expertise in the study of obesity and diabetes. At present, holds a postdoctoral position at CMPL, Faculty of Medicine, Pontificia Universidad Católica de Chile, studying fetoplacental endothelium dysfunction in obesity during pregnancy and GDM. His research regards the alterations of nucleoside membrane transport recycling in these diseases and proposes that gestational diabetes-associated reduction in human equilibrative nucleoside transporters activity involves their increased recycling

potentiated by supraphysiological gain of weight during pregnancy. Luis Sobrevia: Professor Sobrevia (biologists) holds Carnitine dehydrogenase MSc in biological sciences and PhD in biomedicine and physiological sciences, and is focused in the study of fetoplacental vascular dysfunction in diseases of pathology, including GDM. He has proposed metabolic alterations in endothelial cells from the micro- and macrocirculation of the human placenta in GMD. The specific areas or research regards amino acids and nucleosides membrane transport mechanisms and the potential role of adenosine membrane receptors in the modulation of l-arginine transport and NO in these cell types. More recently, the role of insulin receptors as a key factor reversing GDM-associated alterations in human placental endothelium has been reported. “
“Please cite this paper as: Serre and Sasongko (2012). Modifiable Lifestyle and Environmental Risk Factors Affecting the Retinal Microcirculation. Microcirculation 19(1), 29–36. Structural changes within the human retinal vasculature may reflect systemic vascular changes associated with various cardiovascular and metabolic disorders.

“
“Faster, better, more” is the conventional benchmark used to define responses of memory T cells when compared with their naïve counterparts. In this issue of the European Journal of Immunology, Mark and Warren Shlomchik and colleagues [Eur. J. Immunol. 2011. 41: 2782–2792] make the intriguing observation that murine memory CD4+ T-cell populations enriched for alloreactive precursors

are fully capable of rejecting allogeneic skin grafts but yet are incapable of inducing significant Inhibitor Library ic50 graft-versus-host disease. These observations add to the emerging concept that memory CD4+ T-cell development is more nuanced and complex than predicted by conventional models. In particular, the data suggest that it may

be just as important to consider what naïve or effector cells have “lost” in their transition Neratinib clinical trial to memory. Memory T cells with reactivity against alloantigens are generally considered to constitute a major barrier to successful solid organ transplantation 1. Alloreactive memory CD4+ T-cell populations rapidly generate secondary effectors or provide help to B cells to promote the generation of alloantigen-specific antibody. These memory cells are resistant to both tolerance induction through costimulatory blockade 2 or immunosuppression by regulatory T cells 3. It might be expected therefore that transfer of such memory CD4+ T-cell populations to allogeneic bone marrow transplantation (BMT) recipients would lead to severe graft-versus-host disease (GVHD). The fact that GVHD does not occur when such experiments are performed, as reported in this issue of the European Journal of Immunology by Mark and Warren Pregnenolone Shlomchik and colleagues 4, suggests an unexpected level of heterogeneity and complexity

in the functions of memory CD4+ T cells. Transfer of donor T cells into recipients during allogeneic experimental BMT induces GVHD in a highly predictable manner 5. The allogeneic T-cell response occurs in the context of host injury induced by the conditioning treatments required prior to BMT, leading to severe inflammation and the rapid accumulation of T-cell effectors in peripheral tissue such as the gut, skin, and liver. Damage to the thymus 6 and the stroma of secondary lymphoid organs (SLOs) and BM 7 leads to a state of profound immunodeficiency, increasing the risk of infection. There has therefore been a strong clinical interest in developing strategies that permit effective immune reconstitution following BMT without induction of GVHD. This provided the incentive for a number of groups to explore the role of individual T-cell subsets in conferring GVHD.

The reporter gene plasmids were as described SB203580 ic50 previously 34. The IRF7-Flag plasmid was a generous gift from Professor Paul Moynagh (NUIM). The IRF3 and IRF7-YFP plasmids were a generous gift from Professor Taniguchi (University of Tokyo). The RIG-I and Mda-5 mammalian expression plasmids were gifts from Professor Steve Goodbourn, University of London. Mal/TIRAP−/−

and TRIF−/− mice were constructed as described previously 5, 17. Mal/TIRAP KO and TRIF−/− mice were on a C57BL/6 background. All mice were confirmed as being homozygous mutants by PCR genotyping of DNA. All the animal protocols used in this study were approved by the Ethical Committee at the National University of Ireland, Maynooth and in accordance with the Animals (Scientific Procedures) Act, 1986, UK. BM-derived macrophages (BMDM) were generated by differentiation

of age- and sex-matched C57BL/6, Mal−/− and TRIF−/− mice for 8 days in complete DMEM medium supplemented with L929-conditioned supernatants. Immortalised cell lines from WT, Mal−/− and TRIF−/− mice were established by infecting primary BM cells with the J2 recombinant retrovirus as described previously 6, 35, 36. Cell lines showed similar patterns of surface receptor expression, Akt targets activation markers and cytokine production in response to various TLR ligands when compared with primary BMDM. Total RNA was isolated from all types of cells using the TRIzol® Reagent according to the manufacturer’s instructions (Invitrogen). Thereafter, total RNA was converted to first strand cDNA as described previously 37. Total cDNA was used as starting material for real-time RT-PCR quantitation with DyNAmo®HS SYBR Green kit (Finnzymes) on a real-time PCR system (DNA Engine OPTICON® system; MJ Research). For the amplification of the specific genes, the Endonuclease following primers were used; mIFN-β,

forward, GGAGATGACGGAGAAGATGC, and reverse, CCCAGTGCTGGAGAAATTGT; hIFN-β, forward, AACTGCAACCTTTCGAAGCC, and reverse, TGTCGCCTACTACCTGTTGTGC; mTNFα, forward, CATCTTCTCAAAATTCGAGTGACAA, and reverse, TGGGAGTAGACAAGGTACAACCC; hTNFα, forward, CACCACTTCGAAACCTGGGA, and reverse, CACTTCACTGTGCAGGCCAC; mMal/TIRAP, forward, GCTTCATCCTCCTCCGT, and reverse, TGTGTTGGTGGCGAGGT; mTLR3, forward, GTGAGTCTGAAGTACCTAAGTC, and reverse, GAACTGGTAGACAGTTGGAGGT. For each mRNA quantification, the housekeeping gene hypoxanthine phosphoribosyltransferase 1 (HPRT) was used as a reference point using the following primers; mHPRT forward, CCCTGAAGTACTCATTATAGTCAAGGGCAT, and reverse, GCTTGCTGGTGAAAAGGACCTCTCGAAG; hHPRT forward, AGCTTGCTGGTGAAAAGGAC, and reverse, TTATAGTCAAGGGCATATCC. Real-time PCR data were analyzed using 2−ΔΔCT method as described previously 38. Human Mal lentiviral shRNA plasmids were from Sigma-Aldrich (Mal MISSION® shRNA). THP1 cells were lentivirally transduced with either the control plasmid (pLKO.1-puro, SCH001) or the plasmid-encoding shRNA specific for Mal/TIRAP (Tirap MISSION® shRNA NM_052887, TRC No. TRCN0000005565).

2e,f). As an organ-specific autoimmune disease, lymphoid infiltration is a significant feature of HT. To determine whether leptin, IL-17 and RORγt mRNA expression were also expressed in local thyroid tissue, we detected significantly up-regulated levels of leptin, IL-17 and RORγt transcripts in the thyroid tissue CX-5461 molecular weight of six HT patients by PCR analysis (Fig. 3). To investigate a potential role of leptin in the development of Th17 cells in vitro, we treated CD4+ T cells from

HT patients with neutralizing leptin monoclonal antibody in the presence of anti-CD3 and anti-CD28 mAb. As shown in Fig. 4, we detected a substantially decreased frequency of CD4+ Th17 cells and RORγt mRNA expression among naive CD4+ T cells cultured in the presence of anti-leptin mAb. Accumulating data indicate that leptin acts as a proinflammatory cytokine in autoimmune disease animal model, such as EAE [17], non-obese diabetic (NOD) mice [18]and experimental arthritis [19]. In human autoimmune thyroid diseases, the role of leptin seems to be more complicated. It has RAD001 nmr been reported

that high levels of plasma leptin in women developed postpartum thyroiditis, suggesting a relationship between leptin and postpartum thyroid disease [16]. However, Sieminska and colleagues showed that concentrations of leptin were not altered in postmenopausal women with Hashimoto’s thyroiditis [20]. The differences between these reported findings may be due to patient age and different disease stages. In the present study, our group showed a modest increased level of plasma leptin in HT patients compared to healthy controls, with a positive correlation between plasma leptin and BMI. Previous studies report that activated T lymphocytes could synthesize and produce leptin as an autocrine/paracrine cytokine [14, 21, 22]. Interestingly, the data presented here provide evidence that CD4+ T cell-derived leptin is increased in HT patients. Our results are consistent with a previous study on SPTLC1 MS patients showing

that activated T cells from relapsing–remitting MS patients secreted consistent amounts of leptin in the culture medium [15]. Extensive investigations have elucidated an important role of the T cell-mediated autoimmune response in enhancing autoimmune thyroid disease. A large amount of intrathyroidal lymphocytes in patients are CD4+ T cells, which have been proposed to be involved in the pathogenesis of HT diseases. The previous report showed that Th1/Th2 skew led to inflammatory factor and infiltrated Th1 cells destroy the thyroid gland in HT patients [1]. However, increasing evidence supports that the Th17 cell (IL-23/IL-17) pathway, rather than the Th1 cell [IL-12/interferon (IFN)-γ) pathway, is critical for the development of autoimmune inflammatory diseases [23, 24].

Thus, these studies suggest that the overall

B cell compartment and its functions are suppressed LY2109761 supplier partially during normal human pregnancy. The full biological significance of such suppression is unclear, but is believed to enable immune tolerance. Aberrant B cell numbers and functions are associated with obstetric complications [42-59]. Earlier studies have shown that complicated pregnancies exhibit an abnormal increase in the frequencies or absolute numbers of circulating maternal B cells (Table 1). For instance, CD5+ B cell counts are significantly higher in patients with anti-phospholipid syndrome (APS) and recurrent spontaneous abortion (RSA) groups than in healthy controls [43, 45-50]. This B cell subset is also increased in placental tissues of RSA patients [50]. The absolute number and percentages of CD19+ B cells are also increased in pregnancy complications FDA approved Drug Library purchase [43, 51-59], and a higher number of CD19+IgD+ B cell numbers are observed in APS mothers with associated risks of thrombotic events [42]. Increases in B cell activation markers and functions have also been reported in pre-eclampsia, intrauterine growth

restriction (IUGR) and pregnancy-induced hypertension (PIH) cases in human studies [52, 58, 60, 61]. Collectively, these studies present the evidence of an association between human pregnancy complications and an abnormal increase in B cell-activated functions and/or numbers. It is not exactly clear what causes these anomalies in the B cell compartment of adverse pregnancies, and whether they simply represent an exacerbation of the pre-existing autoimmune conditions of the mother

that is triggered by the physiological state of pregnancy. Under normal conditions, B lymphopoiesis is suppressed and autoreactive B cells are deleted during pregnancy to maintain maternal–fetal immune tolerance [25-27]. However, these normal regulatory mechanisms are impaired in autoimmunity leading to the expansion of autoreactive B cell subsets and deleterious autoantibody production. This notion is supported strongly by observations of an abnormally increased number of CD19+CD5+, mature CD19+CD27+ and CD19+IgD+ B cells in a number of obstetric conditions (Table 1). Indeed, Protein Tyrosine Kinase inhibitor these B cell subsets are well-known producers of autoantibodies such as rheumatoid factors, anti-thyroid, anti-ssDNA, anti-histone and anti-phospholipid autoantibodies [14, 43, 48, 62-65]. In particular, the autoantibody-producing CD19+CD5+ B cell populations, which possibly include both human B1-like or activated B2 cells, are often expanded in autoimmune conditions such as APS, systemic lupus erythematosus (SLE) and primary Sjögren’s syndrome [43, 65, 66], which are often exacerbated by pregnancy and linked strongly to risks of obstetric complications [9, 10]. Thus, the strong link between CD19+CD5+ B cells and autoimmunity make them a prime candidate for further investigation in pregnancy conditions.

19 Interestingly, IL-10−/− mice showed increased placental size and larger areas of maternal blood sinuses when compared to WT controls.20 These data elucidated a role of IL-10 as a mediator of placental growth and remodeling. It is noteworthy that extravillous trophoblasts from first trimester exhibit poor IL-10 production while expressing high levels of message for matrix JNK inhibition metalloproteinase-9 (MMP9), implying that invading trophoblasts may temporally

downregulate IL-10 expression to maintain their invasive, not necessarily endovascular, potential.21 The maternal–fetal interface is composed of trophoblast cells of fetal origin intermingled with specialized maternal lymphocytes, stromal cells, and endothelial cells that comprise the decidua. Here, we highlight studies that have defined the production of IL-10 by trophoblast cells and subsets of maternal uterine lymphocytes and summarize recent literature that delves into

the intricate network of cellular cross talk that mediates this control. A conundrum in the field of reproductive immunology is the presence of uterine natural killer cells (uNK) throughout the decidua. NK cells operate through the missing self-hypothesis where lack of major selleck chemicals llc histocompatability complex (MHC) antigen presentation on a target cell leads to activation of the NK cells and resultant cytotoxicity.22 In an organ that was once considered immune-privileged, it is difficult to rationalize the presence of NK cells. However, it has been postulated that the expression of non-classical MHC type I molecule HLA-G on trophoblasts, particularly those with Idelalisib manufacturer extravillous differentiation, plays a regulatory role in controlling NK cell

cytotoxic activation.23 Interestingly, IL-10 has been shown to induce HLA-G on trophoblasts.24 HLA-G is present in different isoforms and has become a focus of an intense debate for the exact role that it plays. While the mechanisms of HLA-G-based antigen presentation remain to be fully elucidated, the role of IL-10 as both a paracrine and autocrine regulator of trophoblast activity is apparent. Although villous cytotrophoblasts produce IL-10, it is not clear how trophoblast differentiation and invasion are controlled at this level. IL-10 decreases MMP9 transcription in villous cytotrophoblasts.21,25 This could be one mechanism by which cytotrophoblasts are selected for further differentiation and invasion. Compared to villous cytotrophoblasts, extravillous trophoblasts are intrinsically poor in IL-10 production, thus allowing MMP expression and invasion competency. This may require paracrine activity within the placental meshwork.12,26–28 It is noteworthy that simultaneous activity of progesterone and IL-10 on trophoblasts may work to sequester pro-inflammatory responses and to enhance regulated cross talk between the placenta and the decidua.

By contrast, when IFNAR−/− bone marrow cells were cultured with influenza viruses, the proportion of CD11c+/MHCII+ BMDCs generated was similar to that observed in untreated cultures, suggesting that the IFNAR was required to mediate these effects. To further investigate the role of type 1 IFN, BALB/c bone marrow was cultured in the presence of GM-CSF, with or without Jap or recombinant IFN-α. The data (Fig. 5b) demonstrated that cultures treated with IFN-α showed a reduction

in BMDC production similar to that observed in cultures stimulated with Jap virus. We next examined the effects of neutralizing IFN. Cultures were treated with IFN-α in the presence or absence of neutralizing antibody to IFN-α. AZD1208 The results (Fig. 5c) showed that in the presence of neutralizing antibody the effects of IFN-α were negated and CD11c+/MHCII+ BMDC production was restored to levels corresponding to those observed in unstimulated cultures. To investigate whether the effects of influenza virus were mediated by IFN-α, cultures were treated with the Jap virus in the presence or absence of neutralizing anti-IFN-α (Fig. 5d). The addition of antibody clearly reversed the effects induced by the virus. Taken together, this evidence clearly demonstrates a role for type 1 IFN, signalling through the IFNAR, in mediating

Daporinad molecular weight responses to influenza viruses that lead to the observed changes in BMDC generation. As described above, ligands for TLRs 3, 4 and 9 were shown to initiate changes in haematopoiesis, inducing a marked reduction in BMDC production. In many cells the cytokine

TNF-α is produced in response to MyD88-dependent TLR signalling and this cytokine has also been shown to inhibit haematopoiesis19. To examine a possible role Loperamide for TNF in mediating the observed effects, recombinant TNF-α was added to bone marrow cultures containing GM-CSF. The results (Fig. 6a) show that the addition of TNF-α led to a reduction in the production of CD11c+/MHCII+ BMDC similar to that observed in cultures stimulated with influenza viruses or TLR ligands. The addition of a neutralizing antibody, anti-TNF-α (Fig. 6b), restored the production of CD11c+/MHCII+ BMDCs, confirming that TNF-α was responsible and that the antibody could abolish its effects. To assess whether TNF-α was mediating the effects of LPS and CpG ODN, bone marrow cells were cultured with GM-CSF and these stimuli in the presence or absence of the neutralizing antibody, anti-TNF-α. The resulting data (Fig. 6c) showed that anti-TNF-α had no effect on the modulation of BMDC production by LPS or CpG ODN. Data compiled from cell numbers (Fig. 6d) revealed that although there was little change in the proportion of cells displaying a CD11c+/MHCII+ phenotype, anti-TNF-α did appear to suppress the increase in cell number usually observed to occur in response to LPS and CpG ODN.

The software and databases can now be freely downloaded from http://www.mmass.org. Scedosporium prolificans CBS 116904 (FMR 6649, IHEM 21176, MYMO-2005.22) was a blood isolate (Spain, 1998) received from Centraalbureau voor Schimmelcultures. Scedosporium apiospermum sensu stricto (IHEM 15155) strain was isolated from Hormones antagonist a broncho-alveolar fluid in the Laboratory of Parasitology-Mycology of Angers University Hospital, France). Pseudallescheria boydii strains CBS 119458 (CCF 3082, dH 16421) and CBS 116895 (FMR 6694, IHEM 21168, MYMO 2005.11) were isolates from a nasal cavity of a Husky with a chronic rhinitis

(Chlumec nad Cidlinou, Czech Republic, 1998) or from a human cerebral abscess (Barcelona, Spain, 1999) respectively. Genetic and morphological authenticity and purity of the samples were controlled by culturing and rDNA sequencing. Detailed deposit information can be obtained from Centraalbureau voor Schimmelcultures (CBS, Utrecht, The Netherlands, Selleckchem FK506 http://www.cbs.knaw.nl/databases/) or Belgian co-ordinated Collections of Microorganisms (http://bccm.belspo.be/db/ihem_search_form.php).

Dry spores of Scedosporium strains were obtained at a Biosafety Level two laboratory. Cultivation was carried out in conical Erlenmeyer flasks at room temperature for 21 days with sterilised barleycorn. The inoculum was prepared from a culture performed on Sabouraud-dextrose agar in Petri-dishes (7 days). Spore collection

from the fully sporulated culture in conical Erlenmeyer flasks was carried out by a vacuum collector covered with a 1.0 μm nitrocellulose membrane filter (Maidstone, Whatman, UK) and a stream of nitrogen. The standard cerebroside containing the C18:1(OH) fatty acylation was isolated from Fusarium solani according to standard protocol.5 Fungal cells were extracted with chloroform/methanol (2 : 1 and 1 : 2 v/v), purified and spectrally verified.6 Details of the procedures are described elsewhere.7 Matrix-assisted laser desorption/ionisation (MALDI) of intact spores (approximately on target amount Methamphetamine 0.1 mg) was carried out on APEX™ Ultra 9.4 T FTICR mass spectrometer equipped with Apollo II ESI/MALDI ion source (BrukerDaltonics, Billerica, MA, USA). Mass spectra were acquired in a positive ion mode in 2,5-dihydroxybenzoic acid matrix (30 g l−1 in 50% acetonitrile/0.1% trifluoroacetic acid) using a SmartBeam 200 Hz laser. Experimental details are described elsewhere.8 The MALDI mass spectra were acquired with 512 k data points and were converted using BrukerCompassXport tool (http://www.bdal.de/service-support/software-support-downloads.html). Binary distributions, source code, detailed user’s guide and video tutorials for the mMass software were available from the http://www.mmass.org website. Once the mMass software (the recent version is 3.

The determination of the chemical composition of the extracellular polymeric substances (EPS) of the biofilm matrix, as well as the elucidation of the sensitivity of biofilms to enzymatic degradation should facilitate

the development of new therapies against biofilm-related infections. BMN673 The chemical analyses of EPS had shown qualitative and quantitative variations of their nature, depending on the strains and culture conditions. The poly-N-acetylglucosamine (PNAG) is considered the main component of staphylococcal biofilms. However, certain strains form biofilms without PNAG. In addition to PNAG and proteins, extracellular teichoic acid was identified as a new component of the staphylococcal biofilms. The sensitivity of staphylococcal biofilms to enzymatic treatments depended on their relative chemical composition, and a PNAG-degrading enzyme, in conjunction with proteases, could be an efficient solution to eliminate the staphylococcal biofilms. A detection of specific ‘antibiofilm’

antibodies in the blood serum of patients could serve as a convenient noninvasive and inexpensive diagnostic tool for the detection of foreign body-associated staphylococcal infections. Used as a coating antigen in the enzyme-linked immunosorbent assay test, PNAG did not sufficiently discriminate healthy individuals from the infected patients. selleck chemicals llc While Staphylococcus aureus is known as a pathogen with a number of virulence factors (e.g. exotoxins and enzymes), Staphylococcus epidermidis is mainly a normal inhabitant of the healthy human skin and mucosal microbial communities. As a commensal bacterium, it has a low pathogenic potential. In recent decades, however, S. epidermidis and other coagulase-negative staphylococci

(CoNS) have emerged as a common cause of numerous nosocomial infections, mostly occurring in immunocompromised hosts or patients with implanted medical devices, such as intravascular and peritoneal dialysis catheters, prosthetic heart valves, or orthopaedic implants (Ziebuhr et al., 2006). These infections can be described as ‘chronic polymer-associated infections’ (Götz, 2002). A characteristic feature of this kind of infection is the ability of the causative microorganisms to colonize surfaces of biomaterials in multilayered biofilm-structured AMP deaminase communities of cells enclosed in a self-produced polymeric matrix, an amorphous slimy material, which is loosely bound to staphylococcal cells. This ability to form biofilms is believed to make the microorganisms more resistant to administered antibiotics and to the defence mechanisms of host immunity (von Eiff et al., 1999). Evidence suggests that biofilm formation also plays a role in S. aureus wound infections (Akiyama et al., 1996) and osteomyeltis (Buxton et al., 1987). To date, no efficient treatment or early diagnostics of implant-associated infections has been proposed.